| Accession | MI0022559 | ||||
| Name | hsa-mir-6724-1 | ||||
| similar to following miRCarta precursors | hsa-477.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr21:8,205,315-8,205,406 (+) |
||||
| miRNA | hsa-miR-6724-5p | ||||
| Sequence (5' -> 3') (92 nts) |
CGCUGCGCUUCUGGGCCCGCGGCGGGCGUGGGGCUGCCCGGGCCGGUCGACCAGCGCGCCGUAGCUCCCGAGGCCCGAGCCGCGACCCGCGG | ||||
| MFE | -48.40 kcal/mol | ||||
| first miRBase version | 19.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (3 precursors) |
hsa-mir-6724-1 hsa-mir-3648-1 hsa-mir-3687-1 |
||||
| Family | mir-6724 (MIPF0001920) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Li et al. | Gene | 2012 | 22313525 | Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis. |