Accession | MI0022215 | ||||
Name | hsa-mir-6503 | ||||
similar to following miRCarta precursors | hsa-736-728.1 | ||||
Organism | Homo sapiens | ||||
Genome | GRCh38.p10 | ||||
Location |
chr11:60,209,071-60,209,156 (-) |
||||
miRNA | hsa-miR-6503-5p | ||||
miRNA | hsa-miR-6503-3p | ||||
Sequence (5' -> 3') (86 nts) |
AAUGGUCCCCCCAGGGAGGUCUGCAUUCAAAUCCCCAGAAGCUGAGGAUUAGGGGACUAGGAUGCAGACCUCCCUGGGGGACCAUU | ||||
MFE | -62.00 kcal/mol | ||||
first miRBase version | 19.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (1 precursors) |
hsa-mir-6503 |
||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Joyce et al. | Hum. Mol. Genet. | 2011 | 21807764 | Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome. |