| Accession | MI0022197 | ||||
| Name | pol-mir-122 | ||||
| similar to following miRCarta precursors | pol-834-43631.1 | ||||
| Organism | Paralichthys olivaceus | ||||
| miRNA | pol-miR-122-5p | ||||
| miRNA | pol-miR-122-3p | ||||
| Sequence (5' -> 3') (63 nts) |
CUGUGGAGUGUGACAAUGGUGUUUGUGUCCUGUCUAUCAAACGCCAUUAUCACACUAUAUAGC | ||||
| MFE | -27.50 kcal/mol | ||||
| first miRBase version | 19.0 | ||||
| last miRBase version | 21.0 | ||||
| Family | mir-122 (MIPF0000095) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Fu et al. | PLoS ONE | 2011 | 21818405 | Identification and differential expression of microRNAs during metamorphosis of the Japanese flounder (Paralichthys olivaceus). |