Accession | MI0021857 | ||||
Name | rno-mir-679 | ||||
similar to following miRCarta precursors | rno-29542.1 | ||||
Organism | Rattus norvegicus | ||||
Genome | Rnor_5.0 | ||||
Location |
chr6:143,026,735-143,026,871 (+) |
||||
miRNA | rno-miR-679 | ||||
Sequence (5' -> 3') (137 nts) |
GUCCCUGUGGUGACUUGAGGCUGCUCCCUGUGGCUUUGAACUGUGAGGUGACUCUUGGUGUGUGAUGGCUUUUCAGCAAGGUCUUCCUCACAGUAGCCAUAAGGACACGCCAGCAACGUGACUGAAGGGACAGUGGU | ||||
MFE | -62.90 kcal/mol | ||||
first miRBase version | 19.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (21 precursors) |
rno-mir-379
rno-mir-411 rno-mir-299b rno-mir-299a rno-mir-3579 rno-mir-380 rno-mir-323 rno-mir-758 rno-mir-329 rno-mir-494 rno-mir-679 rno-mir-1193 rno-mir-666 rno-mir-543 rno-mir-495 rno-mir-667 rno-mir-376c rno-mir-376b rno-mir-3595 rno-mir-376a rno-mir-300 |
||||
Family | mir-679 (MIPF0001564) | ||||
Experiments |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Hullin-Matsuda et al. | J. Biol. Chem. | 2012 | 22605339 | Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum. |
2 | Clokie et al. | J. Biol. Chem. | 2012 | 22908386 | MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase. |