Precursor miRBase

ggo-mir-135b (MI0020801)

Accession MI0020801
Name ggo-mir-135b
similar to following miRCarta precursors ggo-321.1
Organism Gorilla gorilla
Genome GorGor3
Location 1:185,486,690-185,486,802 (-)
miRNA ggo-miR-135b
Sequence (5' -> 3')
(113 nts)
CCCUCCACUCUGCUGUGGCCUAUGGCUUUUCAUUCCUAUGUGAUUGCUGUCCCAAACUCAUGUAGGGCUAAAAGCCAUGGGCUACAGUGAGGGGCGAGCUCCUUCUCCUGCGC
MFE -51.50 kcal/mol
first miRBase version 19.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
ggo-mir-135b
Family mir-135 (MIPF0000028)
Experiments
experiment Pubmed link
Illumina 22453055
External DBs
Gene symbol MIR135B
NCBI Gene 102466597

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Dannemann et al. BMC Genomics 2012 22453055 Annotation of primate miRNAs by high throughput sequencing of small RNA libraries.