Precursor miRBase

ggo-mir-486 (MI0020696)

Accession MI0020696
Name ggo-mir-486
similar to following miRCarta precursors ggo-107.1
Organism Gorilla gorilla
Genome GorGor3
Location 8:41,785,961-41,786,072 (-)
miRNA ggo-miR-486
Sequence (5' -> 3')
(112 nts)
UCUCCAUCCUCCCUGGGGCAUCCUGUACUGAGCUGCCCCGAGGCCCUUCAUGCUGCCCAGCUCGGGGCAGCUCAGUACAGGAUACCUCGGGGUGGGAGUCAGCAGGAGGUGA
MFE -73.00 kcal/mol
first miRBase version 19.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
ggo-mir-486
Family mir-486 (MIPF0000220)
Experiments
experiment Pubmed link
Illumina 22453055
External DBs
Gene symbol MIR486
NCBI Gene 102465012

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Dannemann et al. BMC Genomics 2012 22453055 Annotation of primate miRNAs by high throughput sequencing of small RNA libraries.