Precursor miRBase

ggo-mir-383 (MI0020663)

Accession MI0020663
Name ggo-mir-383
similar to following miRCarta precursors ggo-862.1
Organism Gorilla gorilla
Genome GorGor3
Location 8:14,453,114-14,453,224 (-)
miRNA ggo-miR-383
Sequence (5' -> 3')
(111 nts)
CUCCACGUCACCUGCUCCUCAGAUCAGAAGGUGAUUGUGGCUUUGGGUGGAUAUUAAUCAGCCACAGCACUGCCUGGUCAGAAAGAGCAAGUGUCCUAGCCUUUUACCUCA
MFE -37.40 kcal/mol
first miRBase version 19.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
ggo-mir-383
Family mir-383 (MIPF0000137)
Experiments
experiment Pubmed link
Illumina 22453055
External DBs
Gene symbol MIR383
NCBI Gene 102466960

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Dannemann et al. BMC Genomics 2012 22453055 Annotation of primate miRNAs by high throughput sequencing of small RNA libraries.