| Accession | MI0020521 | ||||
| Name | cgr-mir-410 | ||||
| similar to following miRCarta precursors | cgr-1129-302.1 | ||||
| Organism | Cricetulus griseus | ||||
| miRNA | cgr-miR-410-5p | ||||
| miRNA | cgr-miR-410-3p | ||||
| Sequence (5' -> 3') (75 nts) |
CUUGAGGAGAGGUUGUCUGUGAUGAGUUCGCUUUAUUAAUGACGAAUAUAACACAGAUGGCCUGUUUUCAAUACC | ||||
| MFE | -28.80 kcal/mol | ||||
| first miRBase version | 19.0 | ||||
| last miRBase version | 21.0 | ||||
| Family | mir-154 (MIPF0000018) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Hackl et al. | J. Biotechnol. | 2011 | 21392545 | Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering. |