Accession | MI0020520 | ||||
Name | cgr-mir-409 | ||||
similar to following miRCarta precursors | cgr-329-233.1 | ||||
Organism | Cricetulus griseus | ||||
miRNA | cgr-miR-409-5p | ||||
miRNA | cgr-miR-409-3p | ||||
Sequence (5' -> 3') (73 nts) |
CUCGGAGAGAGGUUACCCGAGCAACUUUGCAUCUGGAGGACGAAUGUUGCUCGGUGAACCCCUUUUCGGUAUC | ||||
MFE | -31.60 kcal/mol | ||||
first miRBase version | 19.0 | ||||
last miRBase version | 21.0 | ||||
Family | mir-154 (MIPF0000018) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Hackl et al. | J. Biotechnol. | 2011 | 21392545 | Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering. |