| Accession | MI0020371 | ||||
| Name | cgr-let-7d | ||||
| similar to following miRCarta precursors | cgr-90-98.1 | ||||
| Organism | Cricetulus griseus | ||||
| miRNA | cgr-let-7d-5p | ||||
| miRNA | cgr-let-7d-3p | ||||
| Sequence (5' -> 3') (95 nts) |
GCUCCUAGGAAGAGGUAGUAGGUUGCAUAGUUUUAGGGCAGGGAUUUUGCCCACAAGGAGGUAACUAUACGACCUGCUGCCUUUCUUAGGGCCUU | ||||
| MFE | -46.40 kcal/mol | ||||
| first miRBase version | 19.0 | ||||
| last miRBase version | 21.0 | ||||
| Family | let-7 (MIPF0000002) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Hackl et al. | J. Biotechnol. | 2011 | 21392545 | Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering. |