| Accession | MI0020315 | ||||
| Name | ame-mir-92c | ||||
| similar to following miRCarta precursors | ame-38299.1 | ||||
| Organism | Apis mellifera | ||||
| Genome | AMEL4.5 | ||||
| Location |
CM000066.5:8,056,244-8,056,325 (+) |
||||
| miRNA | ame-miR-92c | ||||
| Sequence (5' -> 3') (82 nts) |
GGAUACUGGCAGGUUGGGAUGUGGGCAUUAUUUGUUGCAAGGUUAGAUCAAAUUGCACUCGUCCCGGCCUGCUGGAUCUAGU | ||||
| MFE | -36.20 kcal/mol | ||||
| first miRBase version | 19.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
ame-mir-92a
ame-mir-92c |
||||
| Family | mir-25 (MIPF0000013) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Liu et al. | Insect Mol. Biol. | 2012 | 22458842 | Next-generation small RNA sequencing for microRNAs profiling in Apis mellifera: comparison between nurses and foragers. |