| Accession | MI0019443 | ||||
| Name | ola-let-7e | ||||
| similar to following miRCarta precursors | ola-40091.1 | ||||
| potential naming conflicts with | ola-let-7e (MIMAT0022565) | ||||
| Organism | Oryzias latipes | ||||
| Genome | MEDAKA1 | ||||
| Location |
7:13,613,915-13,613,999 (+) |
||||
| miRNA | ola-let-7e | ||||
| Sequence (5' -> 3') (85 nts) |
UUGGGGCUGAGGUAGUAGAUUGAAUAGUUGUGGGGUUUUCCGACCUCUUUCUUCAGUUAACUAUACAAUCUACUGUCUUUCCCAA | ||||
| MFE | -31.70 kcal/mol | ||||
| first miRBase version | 18.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
ola-let-7e ola-let-7a-2 |
||||
| Family | let-7 (MIPF0000002) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Li et al. | BMC Genomics | 2010 | 21143817 | Discovery and characterization of medaka miRNA genes by next generation sequencing platform. |