| Accession | MI0019297 | ||||
| Name | hsa-mir-5692a-1 | ||||
| similar to following miRCarta precursors | hsa-2211.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr7:97,963,658-97,963,726 (+) |
||||
| miRNA | hsa-miR-5692a | ||||
| Sequence (5' -> 3') (69 nts) |
GACAGUACAAAUAAUACCACAGUGGGUGUACCUCAUGUGUGUACACCCUGUGAUAUUAUUUGUAAUAUC | ||||
| MFE | -26.30 kcal/mol | ||||
| first miRBase version | 18.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
hsa-mir-5692a-1 hsa-mir-5692c-2 |
||||
| Family | mir-5692 (MIPF0001351) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Watahiki et al. | PLoS ONE | 2011 | 21980368 | MicroRNAs associated with metastatic prostate cancer. |