| Accession | MI0018565 | ||||
| Name | asu-mir-100c | ||||
| similar to following miRCarta precursors | asu-41658-41657.1 | ||||
| Organism | Ascaris suum | ||||
| miRNA | asu-miR-100c-5p | ||||
| miRNA | asu-miR-100c-3p | ||||
| Sequence (5' -> 3') (93 nts) |
AGCCGGUGUGCGGUGUACCCGUAGCUCCGAAAUCGUGUCAGCAUUUGAAUACACGUUUCGUUGCUCGGGUGCCCUGCGCAUAUUUCCGGGGUC | ||||
| MFE | -44.00 kcal/mol | ||||
| first miRBase version | 18.0 | ||||
| last miRBase version | 21.0 | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Wang et al. | Genome Res. | 2011 | 21685128 | Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles. |