| Accession | MI0018562 | ||||
| Name | asu-mir-100a-1 | ||||
| similar to following miRCarta precursors | asu-31797-41659.1 | ||||
| Organism | Ascaris suum | ||||
| miRNA | asu-miR-100a-5p | ||||
| miRNA | asu-miR-100a-1-3p | ||||
| Sequence (5' -> 3') (77 nts) |
GGCGGUAAACCCGUAGAUCCGAACUUGUGUUGUGUAUUUGGUAACGCAAUUCGCCUCUCGGGUGCAUCGCUGAUUAG | ||||
| MFE | -29.70 kcal/mol | ||||
| first miRBase version | 18.0 | ||||
| last miRBase version | 21.0 | ||||
| Family | mir-10 (MIPF0000033) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Wang et al. | Genome Res. | 2011 | 21685128 | Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles. |