| Accession | MI0018042 | ||||
| Name | mmu-mir-5130 | ||||
| similar to following miRCarta precursors | mmu-25346.1 | ||||
| Organism | Mus musculus | ||||
| Genome | GRCm38.p5 | ||||
| Location |
chr14:102,982,549-102,982,632 (-) |
||||
| miRNA | mmu-miR-5130 | ||||
| Sequence (5' -> 3') (84 nts) |
CCUGGAGCGCGCGGGCGAGGCAGGCGCAGCGCACCGGGGCUCUCGUGGGCGCACUGCUGCGCGCUCGCACCGCGCGGCUCUCAG | ||||
| MFE | -51.20 kcal/mol | ||||
| first miRBase version | 17.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
mmu-mir-5130 |
||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Spierings et al. | Blood | 2011 | 21403133 | Ordered progression of stage-specific miRNA profiles in the mouse B2 B-cell lineage. |