| Accession | MI0018008 | ||||
| Name | mmu-mir-5100 | ||||
| similar to following miRCarta precursors | mmu-25069.1 | ||||
| Organism | Mus musculus | ||||
| Genome | GRCm38.p5 | ||||
| Location |
chr11:60,728,663-60,728,726 (+) |
||||
| miRNA | mmu-miR-5100 | ||||
| Sequence (5' -> 3') (64 nts) |
GUGGGAGGGAGGACUUGGGAACUGAAGAGCAGAGUUCGAAUCCCAGCGGUGCCUCUUCCCGACU | ||||
| MFE | -24.80 kcal/mol | ||||
| first miRBase version | 17.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
mmu-mir-5100 |
||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Spierings et al. | Blood | 2011 | 21403133 | Ordered progression of stage-specific miRNA profiles in the mouse B2 B-cell lineage. |