| Accession | MI0017432 | ||||
| Name | hsa-mir-2467 | ||||
| similar to following miRCarta precursors | hsa-934-2053.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr2:239,351,724-239,351,804 (-) |
||||
| miRNA | hsa-miR-2467-5p | ||||
| miRNA | hsa-miR-2467-3p | ||||
| Sequence (5' -> 3') (81 nts) |
GGACAGGCACCUGAGGCUCUGUUAGCCUUGGCUCUGGGUCCUGCUCCUUAGAGCAGAGGCAGAGAGGCUCAGGGUCUGUCU | ||||
| MFE | -49.90 kcal/mol | ||||
| first miRBase version | 17.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-2467 |
||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Hansen et al. | RNA Biol | 2011 | 21558790 | Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis. |
| 2 | Persson et al. | Cancer Res. | 2011 | 21199797 | Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. |