Accession | MI0017432 | ||||
Name | hsa-mir-2467 | ||||
similar to following miRCarta precursors | hsa-934-2053.1 | ||||
Organism | Homo sapiens | ||||
Genome | GRCh38.p10 | ||||
Location |
chr2:239,351,724-239,351,804 (-) |
||||
miRNA | hsa-miR-2467-5p | ||||
miRNA | hsa-miR-2467-3p | ||||
Sequence (5' -> 3') (81 nts) |
GGACAGGCACCUGAGGCUCUGUUAGCCUUGGCUCUGGGUCCUGCUCCUUAGAGCAGAGGCAGAGAGGCUCAGGGUCUGUCU | ||||
MFE | -49.90 kcal/mol | ||||
first miRBase version | 17.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (1 precursors) |
hsa-mir-2467 |
||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Persson et al. | Cancer Res. | 2011 | 21199797 | Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. |
2 | Hansen et al. | RNA Biol | 2011 | 21558790 | Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis. |