| Accession | MI0017430 | ||||
| Name | hsa-mir-4785 | ||||
| similar to following miRCarta precursors | hsa-1202.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr2:160,407,810-160,407,882 (-) |
||||
| miRNA | hsa-miR-4785 | ||||
| Sequence (5' -> 3') (73 nts) |
GUAGGUGGGGACGCGGCGGCGCUGCUCCUCCGCUGCCGCCGGGAGAGUCGGCGACGCCGCCAGCUCCGCGCGC | ||||
| MFE | -39.80 kcal/mol | ||||
| first miRBase version | 17.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-4785 |
||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Persson et al. | Cancer Res. | 2011 | 21199797 | Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. |