| Accession | MI0017290 | ||||
| Name | hsa-mir-4662a | ||||
| similar to following miRCarta precursors | hsa-299-1948.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr8:124,821,985-124,822,051 (+) |
||||
| miRNA | hsa-miR-4662a-5p | ||||
| miRNA | hsa-miR-4662a-3p | ||||
| Sequence (5' -> 3') (67 nts) |
UCUAUUUAGCCAAUUGUCCAUCUUUAGCUAUUCUGAAUGCCUAAAGAUAGACAAUUGGCUAAAUAGA | ||||
| MFE | -35.50 kcal/mol | ||||
| first miRBase version | 17.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
hsa-mir-4662b
hsa-mir-4662a |
||||
| Family | mir-4662 (MIPF0001245) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Joyce et al. | Hum. Mol. Genet. | 2011 | 21807764 | Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome. |
| 2 | Persson et al. | Cancer Res. | 2011 | 21199797 | Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. |
| 3 | Friedländer et al. | Nucleic Acids Res. | 2012 | 21911355 | miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades. |