Precursor miRBase

hsa-mir-4662a (MI0017290)

Accession MI0017290
Name hsa-mir-4662a
similar to following miRCarta precursors hsa-299-1948.1
Organism Homo sapiens
Genome GRCh38.p10
Location chr8:124,821,985-124,822,051 (+)
miRNA hsa-miR-4662a-5p
miRNA hsa-miR-4662a-3p
Sequence (5' -> 3')
(67 nts)
UCUAUUUAGCCAAUUGUCCAUCUUUAGCUAUUCUGAAUGCCUAAAGAUAGACAAUUGGCUAAAUAGA
MFE -35.50 kcal/mol
first miRBase version 17.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
hsa-mir-4662b
hsa-mir-4662a
Family mir-4662 (MIPF0001245)
Experiments
experiment Pubmed link
Illumina 21199797 21807764
External DBs
Gene symbol MIR4662A
NCBI Gene 100616221

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Joyce et al. Hum. Mol. Genet. 2011 21807764 Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome.
2 Persson et al. Cancer Res. 2011 21199797 Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene.
3 Friedländer et al. Nucleic Acids Res. 2012 21911355 miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades.