| Accession | MI0017276 | ||||
| Name | hsa-mir-4649 | ||||
| similar to following miRCarta precursors | hsa-1845-1434.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr7:44,110,849-44,110,912 (+) |
||||
| miRNA | hsa-miR-4649-5p | ||||
| miRNA | hsa-miR-4649-3p | ||||
| Sequence (5' -> 3') (64 nts) |
UCUGGGCGAGGGGUGGGCUCUCAGAGGGGCUGGCAGUACUGCUCUGAGGCCUGCCUCUCCCCAG | ||||
| MFE | -43.90 kcal/mol | ||||
| first miRBase version | 17.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-4649 |
||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Persson et al. | Cancer Res. | 2011 | 21199797 | Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. |