Accession | MI0017052 | ||||
Name | pma-mir-100a | ||||
similar to following miRCarta precursors | pma-27-38332.1 | ||||
Organism | Petromyzon marinus | ||||
Genome | Pmarinus_7.0 | ||||
Location |
GL476441.1:180,226-180,314 (-) |
||||
miRNA | pma-miR-100a-5p | ||||
miRNA | pma-miR-100a-3p | ||||
Sequence (5' -> 3') (89 nts) |
UCCGCCGGUCGCCACAAACCCGUAGAUCCGAACUUGUGGUGGGAGUUUUGCACAAGCUCGUGUCUACGGGUCUGUGUCGGCAGGGCACG | ||||
MFE | -45.40 kcal/mol | ||||
first miRBase version | 17.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (3 precursors) |
pma-mir-125
pma-mir-100a pma-mir-100c |
||||
Family | mir-10 (MIPF0000033) | ||||
Experiments |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Heimberg et al. | Proc. Natl. Acad. Sci. U.S.A. | 2010 | 20959416 | microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate. |