| Accession | MI0017034 | ||||
| Name | pma-mir-27b | ||||
| similar to following miRCarta precursors | pma-38383-25895.1 | ||||
| Organism | Petromyzon marinus | ||||
| Genome | Pmarinus_7.0 | ||||
| Location |
GL477371.1:165,960-166,034 (-) |
||||
| miRNA | pma-miR-27b-5p | ||||
| miRNA | pma-miR-27b-3p | ||||
| Sequence (5' -> 3') (75 nts) |
UCCGGUGAAGGGCUUAACCCACCUGUGAGCAGCGCUUUACGAUAAGUGUUCACAGUGGCUAAGUUCUGCAUCUGU | ||||
| MFE | -28.50 kcal/mol | ||||
| first miRBase version | 17.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
pma-mir-27b pma-mir-23b |
||||
| Family | mir-27 (MIPF0000036) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Heimberg et al. | Proc. Natl. Acad. Sci. U.S.A. | 2010 | 20959416 | microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate. |