| Accession | MI0017031 | ||||
| Name | pma-mir-26a-2 | ||||
| similar to following miRCarta precursors | pma-34-38368.1 | ||||
| Organism | Petromyzon marinus | ||||
| Genome | Pmarinus_7.0 | ||||
| Location |
GL477073.1:186,582-186,672 (+) |
||||
| miRNA | pma-miR-26a-5p | ||||
| miRNA | pma-miR-26a-2-3p | ||||
| Sequence (5' -> 3') (91 nts) |
CUUUAGGCUGACACCCUGUUCAAGUAAUCCAGGAUAGGCUGUGUUACUCGUGGGCCUUUCCUCGGUUGCUUGAUCCGGGUGUAGUCUGCAA | ||||
| MFE | -43.40 kcal/mol | ||||
| first miRBase version | 17.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
pma-mir-26a-2 |
||||
| Family | mir-26 (MIPF0000043) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Heimberg et al. | Proc. Natl. Acad. Sci. U.S.A. | 2010 | 20959416 | microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate. |