| Accession | MI0017027 | ||||
| Name | pma-mir-23b | ||||
| similar to following miRCarta precursors | pma-38384.1 | ||||
| Organism | Petromyzon marinus | ||||
| Genome | Pmarinus_7.0 | ||||
| Location |
GL477371.1:167,592-167,676 (-) |
||||
| miRNA | pma-miR-23b | ||||
| Sequence (5' -> 3') (85 nts) |
CGAGGGCCGGAGGGUUCCUGGCAAGGUGAUUUGCGACUGCGUUUCUAAGAAAAAUCACAUUGCCAGGGAUUACCACUGGCCCUCG | ||||
| MFE | -47.40 kcal/mol | ||||
| first miRBase version | 17.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
pma-mir-27b
pma-mir-23b |
||||
| Family | mir-23 (MIPF0000027) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Heimberg et al. | Proc. Natl. Acad. Sci. U.S.A. | 2010 | 20959416 | microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate. |