| Accession | MI0017015 | ||||
| Name | pma-mir-17b | ||||
| similar to following miRCarta precursors | pma-38417.1 | ||||
| Organism | Petromyzon marinus | ||||
| Genome | Pmarinus_7.0 | ||||
| Location |
GL478379.1:404,297-404,390 (+) |
||||
| miRNA | pma-miR-17b | ||||
| Sequence (5' -> 3') (94 nts) |
CUGUGGGCGUGCAUUGUUAAAGUGCAGAUAGUGGUAGUUGGUCCUAAAAAUGACAGCUACUCUAUUUACACUUUAAACACUGUGCGGUCCCAAU | ||||
| MFE | -36.30 kcal/mol | ||||
| first miRBase version | 17.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (8 precursors) |
pma-mir-17a
pma-mir-18b pma-mir-17b pma-mir-19c pma-mir-20a pma-mir-19b pma-mir-92a pma-mir-25b |
||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Heimberg et al. | Proc. Natl. Acad. Sci. U.S.A. | 2010 | 20959416 | microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate. |