| Accession | MI0016962 | ||||
| Name | oar-mir-323c | ||||
| similar to following miRCarta precursors | oar-36894.1 | ||||
| Organism | Ovis aries | ||||
| Genome | Oar_v3.1 | ||||
| Location |
chr18:64,660,418-64,660,527 (+) |
||||
| miRNA | oar-miR-323c | ||||
| Sequence (5' -> 3') (110 nts) |
GCGUGCUGCUGCACUUGAUGCUUGAGGAGAGGUUGCCCGUGGCCGGUUCGCAUUCUUCAUGUCGCACAAUACACGGUCGGCCUCUCUUCGGUAUCAAAUCCCACCUUGCA | ||||
| MFE | -47.20 kcal/mol | ||||
| first miRBase version | 17.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (12 precursors) |
oar-mir-323b
oar-mir-154a oar-mir-154b oar-mir-496 oar-mir-377 oar-mir-541 oar-mir-3957 oar-mir-409 oar-mir-412 oar-mir-369 oar-mir-410 oar-mir-323c |
||||
| Family | mir-154 (MIPF0000018) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Caiment et al. | Genome Res. | 2010 | 20944086 | Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing. |