| Accession | MI0016943 | ||||
| Name | oar-mir-544 | ||||
| similar to following miRCarta precursors | oar-36887-27893.1 | ||||
| Organism | Ovis aries | ||||
| Genome | Oar_v3.1 | ||||
| Location |
chr18:64,642,597-64,642,697 (+) |
||||
| miRNA | oar-miR-544-5p | ||||
| miRNA | oar-miR-544-3p | ||||
| Sequence (5' -> 3') (101 nts) |
UCAGAUUUUCAUCACCUAGGGAUCUUGUUAAAAGGCAGAUUCUGAUUCAGGGACCAAGAUUCUGCAUUUUUAGCAAGUUCCCAAGUGAUGCUAAUGCUUCU | ||||
| MFE | -36.30 kcal/mol | ||||
| first miRBase version | 17.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (20 precursors) |
oar-mir-376e
oar-mir-376c oar-mir-376d oar-mir-654 oar-mir-376b oar-mir-376a oar-mir-1185 oar-mir-3956 oar-mir-381 oar-mir-487b oar-mir-539 oar-mir-544 oar-mir-655 oar-mir-3959 oar-mir-487a oar-mir-382 oar-mir-134 oar-mir-668 oar-mir-485 oar-mir-323b |
||||
| Family | mir-544 (MIPF0000436) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Caiment et al. | Genome Res. | 2010 | 20944086 | Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing. |