| Accession | MI0016932 | ||||
| Name | oar-mir-376e | ||||
| similar to following miRCarta precursors | oar-36882-27890.1 | ||||
| Organism | Ovis aries | ||||
| Genome | Oar_v3.1 | ||||
| Location |
chr18:64,634,599-64,634,704 (+) |
||||
| miRNA | oar-miR-376e-5p | ||||
| miRNA | oar-miR-376e-3p | ||||
| Sequence (5' -> 3') (106 nts) |
GCUCAAUGUUUGAUAUUCAAAAGGUGGAUAUUCCUUCUAUGUUUACAGGAUUGACAGCUAAACAUAGAGGAAAAUCCACAUUUUAAGUAUCUAAAUUUGCUUUUGA | ||||
| MFE | -30.90 kcal/mol | ||||
| first miRBase version | 17.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (18 precursors) |
oar-mir-494
oar-mir-1193 oar-mir-543 oar-mir-495 oar-mir-3958 oar-mir-376e oar-mir-376c oar-mir-376d oar-mir-654 oar-mir-376b oar-mir-376a oar-mir-1185 oar-mir-3956 oar-mir-381 oar-mir-487b oar-mir-539 oar-mir-544 oar-mir-655 |
||||
| Family | mir-368 (MIPF0000091) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Caiment et al. | Genome Res. | 2010 | 20944086 | Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing. |