Accession | MI0016919 | ||||
Name | oar-mir-299 | ||||
similar to following miRCarta precursors | oar-27880-41311.1 | ||||
Organism | Ovis aries | ||||
Genome | Oar_v3.1 | ||||
Location |
chr18:64,620,132-64,620,192 (+) |
||||
miRNA | oar-miR-299-5p | ||||
miRNA | oar-miR-299-3p | ||||
Sequence (5' -> 3') (61 nts) |
GAAAUGGUUUACCGUCCCACAUACAUUCUGAAUAUGUAUGUGGGACGGUAAACCACAAAAG | ||||
MFE | -39.00 kcal/mol | ||||
first miRBase version | 17.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (14 precursors) |
oar-mir-379
oar-mir-411a oar-mir-299 oar-mir-380 oar-mir-411b oar-mir-1197 oar-mir-323a oar-mir-758 oar-mir-329b oar-mir-329a oar-mir-494 oar-mir-1193 oar-mir-543 oar-mir-495 |
||||
Family | mir-299 (MIPF0000186) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Caiment et al. | Genome Res. | 2010 | 20944086 | Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing. |