| Accession | MI0016917 | ||||||
| Name | oar-mir-379 | ||||||
| similar to following miRCarta precursors | oar-36876-645.1 | ||||||
| Organism | Ovis aries | ||||||
| Genome | Oar_v3.1 | ||||||
| Location |
chr18:64,618,367-64,618,491 (+) |
||||||
| miRNA | oar-miR-379-5p | ||||||
| miRNA | oar-miR-379-3p | ||||||
| Sequence (5' -> 3') (125 nts) |
CUGAUUCUGGGGUCAGCACCACUCCACGGUUCCUGCAGAGAUGGUAGACUAUGGAACGUAGGCUGUGUGAUUUCUGACCUAUGUAACAUGGUCCACUAACUCUCAGUAUCCAAUCCGUCCUCGGA | ||||||
| MFE | -41.80 kcal/mol | ||||||
| first miRBase version | 17.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (12 precursors) |
oar-mir-379 oar-mir-411a oar-mir-299 oar-mir-380 oar-mir-411b oar-mir-1197 oar-mir-323a oar-mir-758 oar-mir-329b oar-mir-329a oar-mir-494 oar-mir-1193 |
||||||
| Family | mir-379 (MIPF0000126) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Caiment et al. | Genome Res. | 2010 | 20944086 | Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing. |
| 2 | Galio et al. | Physiol. Genomics | 2013 | 23269700 | MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200. |