| Accession | MI0016913 | ||||
| Name | oar-mir-665 | ||||
| similar to following miRCarta precursors | oar-41308-27877.1 | ||||
| Organism | Ovis aries | ||||
| Genome | Oar_v3.1 | ||||
| Location |
chr18:64,475,983-64,476,077 (+) |
||||
| miRNA | oar-miR-665-5p | ||||
| miRNA | oar-miR-665-3p | ||||
| Sequence (5' -> 3') (95 nts) |
CUGGAGGAGGGUCUCCUUGAGGGGUCUUGGCCUCUGCCCAGGACUCUUUCAUGACCAGUAGGCCGAGGCCCCUCACAGGCGGCUGCUUACUCUCC | ||||
| MFE | -51.10 kcal/mol | ||||
| first miRBase version | 17.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (7 precursors) |
oar-mir-493
oar-mir-665 oar-mir-431 oar-mir-433 oar-mir-127 oar-mir-432 oar-mir-136 |
||||
| Family | mir-665 (MIPF0000404) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Caiment et al. | Genome Res. | 2010 | 20944086 | Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing. |