| Accession | MI0016906 | ||||
| Name | hsa-mir-4536-1 | ||||
| similar to following miRCarta precursors | hsa-1740-1393.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chrX:55,451,495-55,451,582 (-) |
||||
| miRNA | hsa-miR-4536-5p | ||||
| miRNA | hsa-miR-4536-3p | ||||
| Sequence (5' -> 3') (88 nts) |
AUGUGGUAGAUAUAUGCACGAUAUAUAUACUGCCCUGCUUUUAUACAUACAUACAUACAUACCUAUAUCGUGCAUAUAUCUACCACAU | ||||
| MFE | -35.95 kcal/mol | ||||
| first miRBase version | 17.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
hsa-mir-4536-2
hsa-mir-4536-1 |
||||
| Family | mir-4536 (MIPF0001319) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Jima et al. | Blood | 2010 | 20733160 | Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs. |
| 2 | Friedländer et al. | Nucleic Acids Res. | 2012 | 21911355 | miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades. |