Accession | MI0016893 | ||||
Name | hsa-mir-4526 | ||||
similar to following miRCarta precursors | hsa-1688.1 | ||||
Organism | Homo sapiens | ||||
Genome | GRCh38.p10 | ||||
Location |
chr18:13,611,114-13,611,200 (+) |
||||
miRNA | hsa-miR-4526 | ||||
Sequence (5' -> 3') (87 nts) |
UGCGGUGACAUCAGGGCCCAGUCCCUGCUGUCAUGCCCCAGGUGACGUGCUGGGCUGACAGCAGGGCUGGCCGCUAACGUCACUGUC | ||||
MFE | -54.30 kcal/mol | ||||
first miRBase version | 17.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (1 precursors) |
hsa-mir-4526 |
||||
Family | mir-4526 (MIPF0001545) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Jima et al. | Blood | 2010 | 20733160 | Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs. |
2 | Persson et al. | Cancer Res. | 2011 | 21199797 | Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. |