Accession | MI0016853 | ||||
Name | hsa-mir-4491 | ||||
similar to following miRCarta precursors | hsa-1142.1 | ||||
Organism | Homo sapiens | ||||
Genome | GRCh38.p10 | ||||
Location |
chr11:111,347,757-111,347,824 (+) |
||||
miRNA | hsa-miR-4491 | ||||
Sequence (5' -> 3') (68 nts) |
ACAUUUGGUCACACCAGUCCACAUUAACGUGGACCAGACAAUAUUAAUGUGGACUGGUGUGACCAAAA | ||||
MFE | -41.30 kcal/mol | ||||
first miRBase version | 17.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (1 precursors) |
hsa-mir-4491 |
||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Jima et al. | Blood | 2010 | 20733160 | Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs. |