| Accession | MI0016821 | ||||
| Name | hsa-mir-4470 | ||||
| similar to following miRCarta precursors | hsa-1215.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr8:61,714,788-61,714,859 (+) |
||||
| miRNA | hsa-miR-4470 | ||||
| Sequence (5' -> 3') (72 nts) |
CGAGCCUCUUUCGGCUUUCCAGUUUGUCUCGGUCCUUUGGAACGUGGCAAACGUGGAAGCCGAGAGGGCUCU | ||||
| MFE | -44.60 kcal/mol | ||||
| first miRBase version | 17.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-4470 |
||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Jima et al. | Blood | 2010 | 20733160 | Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs. |