| Accession | MI0016777 | ||||
| Name | hsa-mir-4435-2 | ||||
| similar to following miRCarta precursors | hsa-983.2 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr2:111,321,013-111,321,086 (-) |
||||
| miRNA | hsa-miR-4435 | ||||
| Sequence (5' -> 3') (74 nts) |
GCAAAUGGCCAGAGCUCACACAGAGGGAUGAGUGCACUUCACCUGCAGUGUGACUCAGCAGGCCAACAGAUGCU | ||||
| MFE | -25.40 kcal/mol | ||||
| first miRBase version | 17.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-4435-2 |
||||
| Family | mir-4435 (MIPF0001220) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Jima et al. | Blood | 2010 | 20733160 | Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs. |