Precursor miRBase

hsa-mir-4423 (MI0016760)

Accession MI0016760
Name hsa-mir-4423
similar to following miRCarta precursors hsa-1093-1341.1
Organism Homo sapiens
Genome GRCh38.p10
Location chr1:85,133,794-85,133,873 (+)
miRNA hsa-miR-4423-5p
miRNA hsa-miR-4423-3p
Sequence (5' -> 3')
(80 nts)
AUCAUGUACUGCAGUUGCCUUUUUGUUCCCAUGCUGUUUAAGCCUAGCAUAGGCACCAAAAAGCAACAACAGUAUGUGAA
MFE -30.60 kcal/mol
first miRBase version 17.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
hsa-mir-4423
Family mir-4423 (MIPF0001587)
Experiments
experiment Pubmed link
Illumina 21199797 21807764
External DBs
Gene symbol MIR4423
NCBI Gene 100616481

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Jima et al. Blood 2010 20733160 Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs.
2 Joyce et al. Hum. Mol. Genet. 2011 21807764 Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome.
3 Persson et al. Cancer Res. 2011 21199797 Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene.
4 Friedländer et al. Nucleic Acids Res. 2012 21911355 miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades.