| Accession | MI0016760 | ||||
| Name | hsa-mir-4423 | ||||
| similar to following miRCarta precursors | hsa-1093-1341.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr1:85,133,794-85,133,873 (+) |
||||
| miRNA | hsa-miR-4423-5p | ||||
| miRNA | hsa-miR-4423-3p | ||||
| Sequence (5' -> 3') (80 nts) |
AUCAUGUACUGCAGUUGCCUUUUUGUUCCCAUGCUGUUUAAGCCUAGCAUAGGCACCAAAAAGCAACAACAGUAUGUGAA | ||||
| MFE | -30.60 kcal/mol | ||||
| first miRBase version | 17.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-4423 |
||||
| Family | mir-4423 (MIPF0001587) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Jima et al. | Blood | 2010 | 20733160 | Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs. |
| 2 | Joyce et al. | Hum. Mol. Genet. | 2011 | 21807764 | Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome. |
| 3 | Persson et al. | Cancer Res. | 2011 | 21199797 | Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. |
| 4 | Friedländer et al. | Nucleic Acids Res. | 2012 | 21911355 | miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades. |