| Accession | MI0003772 | ||||||
| Name | hsa-mir-151b | ||||||
| similar to following miRCarta precursors | hsa-179.1 | ||||||
| Organism | Homo sapiens | ||||||
| Genome | GRCh38.p10 | ||||||
| Location |
chr14:100,109,419-100,109,514 (-) |
||||||
| miRNA | hsa-miR-151b | ||||||
| Sequence (5' -> 3') (96 nts) |
ACCUCUGAUGUGUCAGUCUCUCUUCAGGGCUCCCGAGACACAGAAACAGACACCUGCCCUCGAGGAGCUCACAGUCUAGACAAACAAACCCAGGGU | ||||||
| MFE | -29.90 kcal/mol | ||||||
| first miRBase version | 17.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (2 precursors) |
hsa-mir-151b hsa-mir-342 |
||||||
| Family | mir-28 (MIPF0000057) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Berezikov et al. | Genome Res. | 2006 | 16954537 | Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis. |
| 2 | Jima et al. | Blood | 2010 | 20733160 | Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs. |