| Accession | MI0003762 | ||||
| Name | hsa-mir-550a-3 | ||||
| similar to following miRCarta precursors | hsa-494-408.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr7:29,680,734-29,680,828 (-) |
||||
| miRNA | hsa-miR-550a-3-5p | ||||
| miRNA | hsa-miR-550a-3p | ||||
| Sequence (5' -> 3') (95 nts) |
GAUGCUUUGCUGGCUGGUGCAGUGCCUGAGGGAGUAAGAGUCCUGUUGUUGUAAGAUAGUGUCUUACUCCCUCAGGCACAUCUCCAACAAGUCUC | ||||
| MFE | -44.00 kcal/mol | ||||
| first miRBase version | 17.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-550a-3 |
||||
| Family | mir-550 (MIPF0000334) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Berezikov et al. | Genome Res. | 2006 | 16954537 | Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis. |
| 2 | Jima et al. | Blood | 2010 | 20733160 | Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs. |
| 3 | Friedländer et al. | Nucleic Acids Res. | 2012 | 21911355 | miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades. |