Accession | MI0016685 | ||||
Name | hsa-mir-642b | ||||
similar to following miRCarta precursors | hsa-1456-1785.1 | ||||
Organism | Homo sapiens | ||||
Genome | GRCh38.p10 | ||||
Location |
chr19:45,674,932-45,675,008 (-) |
||||
miRNA | hsa-miR-642b-5p | ||||
miRNA | hsa-miR-642b-3p | ||||
Sequence (5' -> 3') (77 nts) |
GAGUUGGGAGGUUCCCUCUCCAAAUGUGUCUUGAUCCCCCACCCCAAGACACAUUUGGAGAGGGACCCUCCCAACUC | ||||
MFE | -60.20 kcal/mol | ||||
first miRBase version | 16.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (2 precursors) |
hsa-mir-642a
hsa-mir-642b |
||||
Family | mir-642 (MIPF0000468) | ||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Witten et al. | BMC Biol. | 2010 | 20459774 | Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls. |