| Accession | MI0016437 | ||||
| Name | hsa-mir-3926-2 | ||||
| similar to following miRCarta precursors | hsa-1488.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr8:12,727,237-12,727,299 (+) |
||||
| miRNA | hsa-miR-3926 | ||||
| Sequence (5' -> 3') (63 nts) |
GGAGCUGGCCAAAAAGCAGGCAGAGACGCUUUUAAAGUCUCUGCCUGCUUUUUGGCCAGCUCC | ||||
| MFE | -56.70 kcal/mol | ||||
| first miRBase version | 16.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (3 precursors) |
hsa-mir-5692a-2
hsa-mir-3926-1 hsa-mir-3926-2 |
||||
| Family | mir-3926 (MIPF0001118) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Creighton et al. | PLoS ONE | 2010 | 20224791 | Discovery of novel microRNAs in female reproductive tract using next generation sequencing. |
| 2 | Persson et al. | Cancer Res. | 2011 | 21199797 | Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. |