| Accession | MI0016426 | ||||
| Name | hsa-mir-3150b | ||||
| similar to following miRCarta precursors | hsa-1944-676.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr8:95,072,911-95,072,996 (-) |
||||
| miRNA | hsa-miR-3150b-5p | ||||
| miRNA | hsa-miR-3150b-3p | ||||
| Sequence (5' -> 3') (86 nts) |
GAGGGAAAGCAGGCCAACCUCGAGGAUCUCCCCAGCCUUGGCGUUCAGGUGCUGAGGAGAUCGUCGAGGUUGGCCUGCUUCCCCUC | ||||
| MFE | -70.80 kcal/mol | ||||
| first miRBase version | 16.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
hsa-mir-3150b hsa-mir-3150a |
||||
| Family | mir-3150 (MIPF0001102) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Creighton et al. | PLoS ONE | 2010 | 20224791 | Discovery of novel microRNAs in female reproductive tract using next generation sequencing. |
| 2 | Schotte et al. | Leukemia | 2011 | 21606961 | Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia. |
| 3 | Persson et al. | Cancer Res. | 2011 | 21199797 | Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. |