Accession | MI0016089 | ||||
Name | hsa-mir-3688-1 | ||||
similar to following miRCarta precursors | hsa-2392-1003.1 | ||||
Organism | Homo sapiens | ||||
Genome | GRCh38.p10 | ||||
Location |
chr4:159,128,802-159,128,894 (-) |
||||
miRNA | hsa-miR-3688-5p | ||||
miRNA | hsa-miR-3688-3p | ||||
Sequence (5' -> 3') (93 nts) |
UCUUCACUUUCAAGAGUGGCAAAGUCUUUCCAUAUGUAUGUAUGUAUGUCUGUUACACAUAUGGAAAGACUUUGCCACUCUUUAAAGUGAAGA | ||||
MFE | -57.00 kcal/mol | ||||
first miRBase version | 16.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (2 precursors) |
hsa-mir-3688-1 hsa-mir-3688-2 |
||||
Family | mir-3688 (MIPF0001263) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Vaz et al. | BMC Genomics | 2010 | 20459673 | Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood. |
2 | Persson et al. | Cancer Res. | 2011 | 21199797 | Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. |