| Accession | MI0016088 | ||||
| Name | hsa-mir-3687-1 | ||||
| similar to following miRCarta precursors | hsa-668.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr21:8,208,844-8,208,904 (+) |
||||
| miRNA | hsa-miR-3687 | ||||
| Sequence (5' -> 3') (61 nts) |
CGCGCGUGCGCCCGAGCGCGGCCCGGUGGUCCCUCCCGGACAGGCGUUCGUGCGACGUGUG | ||||
| MFE | -32.90 kcal/mol | ||||
| first miRBase version | 16.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (3 precursors) |
hsa-mir-6724-1
hsa-mir-3648-1 hsa-mir-3687-1 |
||||
| Family | mir-3687 (MIPF0002051) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Vaz et al. | BMC Genomics | 2010 | 20459673 | Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood. |