| Accession | MI0016078 | ||||
| Name | hsa-mir-3677 | ||||
| similar to following miRCarta precursors | hsa-685-443.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr16:2,270,713-2,270,772 (+) |
||||
| miRNA | hsa-miR-3677-5p | ||||
| miRNA | hsa-miR-3677-3p | ||||
| Sequence (5' -> 3') (60 nts) |
GGCAGUGGCCAGAGCCCUGCAGUGCUGGGCAUGGGCUUCUCGUGGGCUCUGGCCACGGCC | ||||
| MFE | -38.80 kcal/mol | ||||
| first miRBase version | 16.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (3 precursors) |
hsa-mir-3677 hsa-mir-940 hsa-mir-4717 |
||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Vaz et al. | BMC Genomics | 2010 | 20459673 | Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood. |
| 2 | Persson et al. | Cancer Res. | 2011 | 21199797 | Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. |