| Accession | MI0004130 | ||||
| Name | mmu-mir-1264 | ||||
| similar to following miRCarta precursors | mmu-3240-25747.1 | ||||
| Organism | Mus musculus | ||||
| Genome | GRCm38.p5 | ||||
| Location |
chrX:147,010,601-147,010,686 (+) |
||||
| miRNA | mmu-miR-1264-5p | ||||
| miRNA | mmu-miR-1264-3p | ||||
| Sequence (5' -> 3') (86 nts) |
CCUGGCAUAUAGCAGGUCCUCAAUAAGUAUUUGUUGAAAAAAUAAAUGAAGCAACAAAUCUUAUUUGAGCACCUGUUAUGUGGAGG | ||||
| MFE | -34.30 kcal/mol | ||||
| first miRBase version | 16.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (3 precursors) |
mmu-mir-764
mmu-mir-1912 mmu-mir-1264 |
||||
| Family | mir-95 (MIPF0000098) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Berezikov et al. | Genome Res. | 2006 | 16954537 | Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis. |
| 2 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |