Accession | MI0004130 | ||||
Name | mmu-mir-1264 | ||||
similar to following miRCarta precursors | mmu-3240-25747.1 | ||||
Organism | Mus musculus | ||||
Genome | GRCm38.p5 | ||||
Location |
chrX:147,010,601-147,010,686 (+) |
||||
miRNA | mmu-miR-1264-5p | ||||
miRNA | mmu-miR-1264-3p | ||||
Sequence (5' -> 3') (86 nts) |
CCUGGCAUAUAGCAGGUCCUCAAUAAGUAUUUGUUGAAAAAAUAAAUGAAGCAACAAAUCUUAUUUGAGCACCUGUUAUGUGGAGG | ||||
MFE | -34.30 kcal/mol | ||||
first miRBase version | 16.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (3 precursors) |
mmu-mir-764
mmu-mir-1912 mmu-mir-1264 |
||||
Family | mir-95 (MIPF0000098) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Berezikov et al. | Genome Res. | 2006 | 16954537 | Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis. |
2 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |