| Accession | MI0013954 | ||||
| Name | api-mir-9a | ||||
| similar to following miRCarta precursors | api-105.1 | ||||
| Organism | Acyrthosiphon pisum | ||||
| Genome | Acyr_2.0 | ||||
| Location |
GL349752.1:521,148-521,214 (-) |
||||
| miRNA | api-miR-9a | ||||
| Sequence (5' -> 3') (67 nts) |
UCUUUGGUUAUCUAGCUGUAUGAGUGUUACGUAUGAAGCUCCUCAUAGGUCUAGGUGACCGAAGUUA | ||||
| MFE | -26.70 kcal/mol | ||||
| first miRBase version | 16.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
api-mir-9a |
||||
| Family | mir-9 (MIPF0000014) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Legeai et al. | BMC Genomics | 2010 | 20444247 | Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum. |