| Accession | MI0015852 | ||||
| Name | hsa-mir-4321 | ||||
| similar to following miRCarta precursors | hsa-2565.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr19:2,250,639-2,250,718 (+) |
||||
| miRNA | hsa-miR-4321 | ||||
| Sequence (5' -> 3') (80 nts) |
CUGGUCUCCGCAGAGCCUCUGCCCCUCCCGAGACACCCGCUACCUGGUGUUAGCGGUGGACCGCCCUGCGGGGGCCUGGC | ||||
| MFE | -38.50 kcal/mol | ||||
| first miRBase version | 15.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-4321 |
||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Goff et al. | PLoS ONE | 2009 | 19784364 | Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors. |