Accession | MI0015185 |
Name | ppy-mir-1197 |
similar to following miRCarta precursors | ppy-971.1 |
Organism | Pongo abelii |
Genome | PPYG2 |
Location |
14:102,586,977-102,587,064 (+) |
miRNA | ppy-miR-1197 |
Sequence (5' -> 3') (88 nts) |
ACUUCCUGGUAUUUGAAGAUGCGGUUGACCAUGGUGUGUACGCUUUAUUUAUGACGUAGGACACAUGGUCUACUUCUUCUCAAUAUCA |
MFE | -26.20 kcal/mol |
first miRBase version | 15.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (13 precursors) |
ppy-mir-379
ppy-mir-411 ppy-mir-299 ppy-mir-380 ppy-mir-1197 ppy-mir-323 ppy-mir-758 ppy-mir-329-1 ppy-mir-329-2 ppy-mir-494 ppy-mir-1193 ppy-mir-543 ppy-mir-495 |
Family | mir-379 (MIPF0000126) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |